paper n a plko 1 shnt addgene (Addgene inc)
Addgene inc is a verified supplier 
93
Structured Review
Addgene inc
paper n a plko 1 shnt addgene
Paper N A Plko 1 Shnt Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/paper+n+a+plko+1+shnt+addgene/pLKO%2E1-puro-shNT+(Plasmid+%23109012)/pm41076632-47-166-169
Average 93 stars, based on 11 article reviews
Paper N A Plko 1 Shnt Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/paper+n+a+plko+1+shnt+addgene/pLKO%2E1-puro-shNT+(Plasmid+%23109012)/pm41076632-47-166-169
Average 93 stars, based on 11 article reviews
paper n a plko 1 shnt addgene - by Bioz Stars,
2026-10
93/100 stars
Images
Related Articles
Virus:Article Title: Protocol for monitoring the stability of transcription factor EB using global protein stability assay. Article Snippet: Bacterial and virus strains E. coli DH5α cells Thermo Fisher Scientific Cat# 18265017 Chemicals, peptides, and recombinant proteins Penicillin/Streptomycin Thermo Fisher Scientific Cat# 15070063 Fetal bovine serum Sigma-Aldrich Cat# F0193 DMEM Metacell Cat# C1010 RPMI1640 Metacell Cat# C1120 0.25% Trypsin-EDTA solution Metacell Cat# C1201 Liposomal Transfection Reagent Yeasen Cat# 40802ES03 Polybrene Beyotime Cat# C0351 Puromycin dihydrochloride Beyotime Cat# ST551 Blasticidin S HCl Beyotime Cat# ST018 DAPI dihydrochloride MedChemExpress Cat# HY-D0814 Critical commercial assays Seamless Cloning Kit Beyotime Cat# D7010 MolPure Gel Extraction Kit Yeasen Cat# 19101ES50 Hieff Canace High-Fidelity DNA Polymerase Yeasen Cat# 10135ES60 MolPure Endo-free Plasmid Mini Kit Yeasen Cat# 19021ES50 23 SuperTaq PCR StarMix (dye) GenStar Cat# A002-10 Experimental models: Cell lines HEK293T ATCC Cat# CRL-3216 NCI-H1299 ATCC Cat# CRL-5803 Oligonucleotides Seamless Cloning TFEB forward primer: 5′ TCCATAGAAGCCACCATGGCGTCACGCATAGGG 3′ This paper N/A Seamless Cloning TFEB reverse primer: 5′ ATCGAATTCTCTAGACTTGTCGTCATCGTCTTTG 3′ This Recombinant:Article Title: Protocol for monitoring the stability of transcription factor EB using global protein stability assay. Article Snippet: Bacterial and virus strains E. coli DH5α cells Thermo Fisher Scientific Cat# 18265017 Chemicals, peptides, and recombinant proteins Penicillin/Streptomycin Thermo Fisher Scientific Cat# 15070063 Fetal bovine serum Sigma-Aldrich Cat# F0193 DMEM Metacell Cat# C1010 RPMI1640 Metacell Cat# C1120 0.25% Trypsin-EDTA solution Metacell Cat# C1201 Liposomal Transfection Reagent Yeasen Cat# 40802ES03 Polybrene Beyotime Cat# C0351 Puromycin dihydrochloride Beyotime Cat# ST551 Blasticidin S HCl Beyotime Cat# ST018 DAPI dihydrochloride MedChemExpress Cat# HY-D0814 Critical commercial assays Seamless Cloning Kit Beyotime Cat# D7010 MolPure Gel Extraction Kit Yeasen Cat# 19101ES50 Hieff Canace High-Fidelity DNA Polymerase Yeasen Cat# 10135ES60 MolPure Endo-free Plasmid Mini Kit Yeasen Cat# 19021ES50 23 SuperTaq PCR StarMix (dye) GenStar Cat# A002-10 Experimental models: Cell lines HEK293T ATCC Cat# CRL-3216 NCI-H1299 ATCC Cat# CRL-5803 Oligonucleotides Seamless Cloning TFEB forward primer: 5′ TCCATAGAAGCCACCATGGCGTCACGCATAGGG 3′ This paper N/A Seamless Cloning TFEB reverse primer: 5′ ATCGAATTCTCTAGACTTGTCGTCATCGTCTTTG 3′ This Transfection:Article Title: Protocol for monitoring the stability of transcription factor EB using global protein stability assay. Article Snippet: Bacterial and virus strains E. coli DH5α cells Thermo Fisher Scientific Cat# 18265017 Chemicals, peptides, and recombinant proteins Penicillin/Streptomycin Thermo Fisher Scientific Cat# 15070063 Fetal bovine serum Sigma-Aldrich Cat# F0193 DMEM Metacell Cat# C1010 RPMI1640 Metacell Cat# C1120 0.25% Trypsin-EDTA solution Metacell Cat# C1201 Liposomal Transfection Reagent Yeasen Cat# 40802ES03 Polybrene Beyotime Cat# C0351 Puromycin dihydrochloride Beyotime Cat# ST551 Blasticidin S HCl Beyotime Cat# ST018 DAPI dihydrochloride MedChemExpress Cat# HY-D0814 Critical commercial assays Seamless Cloning Kit Beyotime Cat# D7010 MolPure Gel Extraction Kit Yeasen Cat# 19101ES50 Hieff Canace High-Fidelity DNA Polymerase Yeasen Cat# 10135ES60 MolPure Endo-free Plasmid Mini Kit Yeasen Cat# 19021ES50 23 SuperTaq PCR StarMix (dye) GenStar Cat# A002-10 Experimental models: Cell lines HEK293T ATCC Cat# CRL-3216 NCI-H1299 ATCC Cat# CRL-5803 Oligonucleotides Seamless Cloning TFEB forward primer: 5′ TCCATAGAAGCCACCATGGCGTCACGCATAGGG 3′ This paper N/A Seamless Cloning TFEB reverse primer: 5′ ATCGAATTCTCTAGACTTGTCGTCATCGTCTTTG 3′ This Cloning:Article Title: Protocol for monitoring the stability of transcription factor EB using global protein stability assay. Article Snippet: Bacterial and virus strains E. coli DH5α cells Thermo Fisher Scientific Cat# 18265017 Chemicals, peptides, and recombinant proteins Penicillin/Streptomycin Thermo Fisher Scientific Cat# 15070063 Fetal bovine serum Sigma-Aldrich Cat# F0193 DMEM Metacell Cat# C1010 RPMI1640 Metacell Cat# C1120 0.25% Trypsin-EDTA solution Metacell Cat# C1201 Liposomal Transfection Reagent Yeasen Cat# 40802ES03 Polybrene Beyotime Cat# C0351 Puromycin dihydrochloride Beyotime Cat# ST551 Blasticidin S HCl Beyotime Cat# ST018 DAPI dihydrochloride MedChemExpress Cat# HY-D0814 Critical commercial assays Seamless Cloning Kit Beyotime Cat# D7010 MolPure Gel Extraction Kit Yeasen Cat# 19101ES50 Hieff Canace High-Fidelity DNA Polymerase Yeasen Cat# 10135ES60 MolPure Endo-free Plasmid Mini Kit Yeasen Cat# 19021ES50 23 SuperTaq PCR StarMix (dye) GenStar Cat# A002-10 Experimental models: Cell lines HEK293T ATCC Cat# CRL-3216 NCI-H1299 ATCC Cat# CRL-5803 Oligonucleotides Seamless Cloning TFEB forward primer: 5′ TCCATAGAAGCCACCATGGCGTCACGCATAGGG 3′ This paper N/A Seamless Cloning TFEB reverse primer: 5′ ATCGAATTCTCTAGACTTGTCGTCATCGTCTTTG 3′ This Gel Extraction:Article Title: Protocol for monitoring the stability of transcription factor EB using global protein stability assay. Article Snippet: Bacterial and virus strains E. coli DH5α cells Thermo Fisher Scientific Cat# 18265017 Chemicals, peptides, and recombinant proteins Penicillin/Streptomycin Thermo Fisher Scientific Cat# 15070063 Fetal bovine serum Sigma-Aldrich Cat# F0193 DMEM Metacell Cat# C1010 RPMI1640 Metacell Cat# C1120 0.25% Trypsin-EDTA solution Metacell Cat# C1201 Liposomal Transfection Reagent Yeasen Cat# 40802ES03 Polybrene Beyotime Cat# C0351 Puromycin dihydrochloride Beyotime Cat# ST551 Blasticidin S HCl Beyotime Cat# ST018 DAPI dihydrochloride MedChemExpress Cat# HY-D0814 Critical commercial assays Seamless Cloning Kit Beyotime Cat# D7010 MolPure Gel Extraction Kit Yeasen Cat# 19101ES50 Hieff Canace High-Fidelity DNA Polymerase Yeasen Cat# 10135ES60 MolPure Endo-free Plasmid Mini Kit Yeasen Cat# 19021ES50 23 SuperTaq PCR StarMix (dye) GenStar Cat# A002-10 Experimental models: Cell lines HEK293T ATCC Cat# CRL-3216 NCI-H1299 ATCC Cat# CRL-5803 Oligonucleotides Seamless Cloning TFEB forward primer: 5′ TCCATAGAAGCCACCATGGCGTCACGCATAGGG 3′ This paper N/A Seamless Cloning TFEB reverse primer: 5′ ATCGAATTCTCTAGACTTGTCGTCATCGTCTTTG 3′ This Plasmid Preparation:Article Title: Protocol for monitoring the stability of transcription factor EB using global protein stability assay. Article Snippet: Bacterial and virus strains E. coli DH5α cells Thermo Fisher Scientific Cat# 18265017 Chemicals, peptides, and recombinant proteins Penicillin/Streptomycin Thermo Fisher Scientific Cat# 15070063 Fetal bovine serum Sigma-Aldrich Cat# F0193 DMEM Metacell Cat# C1010 RPMI1640 Metacell Cat# C1120 0.25% Trypsin-EDTA solution Metacell Cat# C1201 Liposomal Transfection Reagent Yeasen Cat# 40802ES03 Polybrene Beyotime Cat# C0351 Puromycin dihydrochloride Beyotime Cat# ST551 Blasticidin S HCl Beyotime Cat# ST018 DAPI dihydrochloride MedChemExpress Cat# HY-D0814 Critical commercial assays Seamless Cloning Kit Beyotime Cat# D7010 MolPure Gel Extraction Kit Yeasen Cat# 19101ES50 Hieff Canace High-Fidelity DNA Polymerase Yeasen Cat# 10135ES60 MolPure Endo-free Plasmid Mini Kit Yeasen Cat# 19021ES50 23 SuperTaq PCR StarMix (dye) GenStar Cat# A002-10 Experimental models: Cell lines HEK293T ATCC Cat# CRL-3216 NCI-H1299 ATCC Cat# CRL-5803 Oligonucleotides Seamless Cloning TFEB forward primer: 5′ TCCATAGAAGCCACCATGGCGTCACGCATAGGG 3′ This paper N/A Seamless Cloning TFEB reverse primer: 5′ ATCGAATTCTCTAGACTTGTCGTCATCGTCTTTG 3′ This Polymerase Chain Reaction:Article Title: Protocol for monitoring the stability of transcription factor EB using global protein stability assay. Article Snippet: Bacterial and virus strains E. coli DH5α cells Thermo Fisher Scientific Cat# 18265017 Chemicals, peptides, and recombinant proteins Penicillin/Streptomycin Thermo Fisher Scientific Cat# 15070063 Fetal bovine serum Sigma-Aldrich Cat# F0193 DMEM Metacell Cat# C1010 RPMI1640 Metacell Cat# C1120 0.25% Trypsin-EDTA solution Metacell Cat# C1201 Liposomal Transfection Reagent Yeasen Cat# 40802ES03 Polybrene Beyotime Cat# C0351 Puromycin dihydrochloride Beyotime Cat# ST551 Blasticidin S HCl Beyotime Cat# ST018 DAPI dihydrochloride MedChemExpress Cat# HY-D0814 Critical commercial assays Seamless Cloning Kit Beyotime Cat# D7010 MolPure Gel Extraction Kit Yeasen Cat# 19101ES50 Hieff Canace High-Fidelity DNA Polymerase Yeasen Cat# 10135ES60 MolPure Endo-free Plasmid Mini Kit Yeasen Cat# 19021ES50 23 SuperTaq PCR StarMix (dye) GenStar Cat# A002-10 Experimental models: Cell lines HEK293T ATCC Cat# CRL-3216 NCI-H1299 ATCC Cat# CRL-5803 Oligonucleotides Seamless Cloning TFEB forward primer: 5′ TCCATAGAAGCCACCATGGCGTCACGCATAGGG 3′ This paper N/A Seamless Cloning TFEB reverse primer: 5′ ATCGAATTCTCTAGACTTGTCGTCATCGTCTTTG 3′ This Modification:Article Title: Protocol for monitoring the stability of transcription factor EB using global protein stability assay. Article Snippet: Bacterial and virus strains E. coli DH5α cells Thermo Fisher Scientific Cat# 18265017 Chemicals, peptides, and recombinant proteins Penicillin/Streptomycin Thermo Fisher Scientific Cat# 15070063 Fetal bovine serum Sigma-Aldrich Cat# F0193 DMEM Metacell Cat# C1010 RPMI1640 Metacell Cat# C1120 0.25% Trypsin-EDTA solution Metacell Cat# C1201 Liposomal Transfection Reagent Yeasen Cat# 40802ES03 Polybrene Beyotime Cat# C0351 Puromycin dihydrochloride Beyotime Cat# ST551 Blasticidin S HCl Beyotime Cat# ST018 DAPI dihydrochloride MedChemExpress Cat# HY-D0814 Critical commercial assays Seamless Cloning Kit Beyotime Cat# D7010 MolPure Gel Extraction Kit Yeasen Cat# 19101ES50 Hieff Canace High-Fidelity DNA Polymerase Yeasen Cat# 10135ES60 MolPure Endo-free Plasmid Mini Kit Yeasen Cat# 19021ES50 23 SuperTaq PCR StarMix (dye) GenStar Cat# A002-10 Experimental models: Cell lines HEK293T ATCC Cat# CRL-3216 NCI-H1299 ATCC Cat# CRL-5803 Oligonucleotides Seamless Cloning TFEB forward primer: 5′ TCCATAGAAGCCACCATGGCGTCACGCATAGGG 3′ This paper N/A Seamless Cloning TFEB reverse primer: 5′ ATCGAATTCTCTAGACTTGTCGTCATCGTCTTTG 3′ This Software:Article Title: Protocol for monitoring the stability of transcription factor EB using global protein stability assay. Article Snippet: Bacterial and virus strains E. coli DH5α cells Thermo Fisher Scientific Cat# 18265017 Chemicals, peptides, and recombinant proteins Penicillin/Streptomycin Thermo Fisher Scientific Cat# 15070063 Fetal bovine serum Sigma-Aldrich Cat# F0193 DMEM Metacell Cat# C1010 RPMI1640 Metacell Cat# C1120 0.25% Trypsin-EDTA solution Metacell Cat# C1201 Liposomal Transfection Reagent Yeasen Cat# 40802ES03 Polybrene Beyotime Cat# C0351 Puromycin dihydrochloride Beyotime Cat# ST551 Blasticidin S HCl Beyotime Cat# ST018 DAPI dihydrochloride MedChemExpress Cat# HY-D0814 Critical commercial assays Seamless Cloning Kit Beyotime Cat# D7010 MolPure Gel Extraction Kit Yeasen Cat# 19101ES50 Hieff Canace High-Fidelity DNA Polymerase Yeasen Cat# 10135ES60 MolPure Endo-free Plasmid Mini Kit Yeasen Cat# 19021ES50 23 SuperTaq PCR StarMix (dye) GenStar Cat# A002-10 Experimental models: Cell lines HEK293T ATCC Cat# CRL-3216 NCI-H1299 ATCC Cat# CRL-5803 Oligonucleotides Seamless Cloning TFEB forward primer: 5′ TCCATAGAAGCCACCATGGCGTCACGCATAGGG 3′ This paper N/A Seamless Cloning TFEB reverse primer: 5′ ATCGAATTCTCTAGACTTGTCGTCATCGTCTTTG 3′ This Stable Transfection:Article Title: Protocol for monitoring the stability of transcription factor EB using global protein stability assay. Article Snippet: Bacterial and virus strains E. coli DH5α cells Thermo Fisher Scientific Cat# 18265017 Chemicals, peptides, and recombinant proteins Penicillin/Streptomycin Thermo Fisher Scientific Cat# 15070063 Fetal bovine serum Sigma-Aldrich Cat# F0193 DMEM Metacell Cat# C1010 RPMI1640 Metacell Cat# C1120 0.25% Trypsin-EDTA solution Metacell Cat# C1201 Liposomal Transfection Reagent Yeasen Cat# 40802ES03 Polybrene Beyotime Cat# C0351 Puromycin dihydrochloride Beyotime Cat# ST551 Blasticidin S HCl Beyotime Cat# ST018 DAPI dihydrochloride MedChemExpress Cat# HY-D0814 Critical commercial assays Seamless Cloning Kit Beyotime Cat# D7010 MolPure Gel Extraction Kit Yeasen Cat# 19101ES50 Hieff Canace High-Fidelity DNA Polymerase Yeasen Cat# 10135ES60 MolPure Endo-free Plasmid Mini Kit Yeasen Cat# 19021ES50 23 SuperTaq PCR StarMix (dye) GenStar Cat# A002-10 Experimental models: Cell lines HEK293T ATCC Cat# CRL-3216 NCI-H1299 ATCC Cat# CRL-5803 Oligonucleotides Seamless Cloning TFEB forward primer: 5′ TCCATAGAAGCCACCATGGCGTCACGCATAGGG 3′ This paper N/A Seamless Cloning TFEB reverse primer: 5′ ATCGAATTCTCTAGACTTGTCGTCATCGTCTTTG 3′ This Expressing:Article Title: Protocol for monitoring the stability of transcription factor EB using global protein stability assay. Article Snippet: Bacterial and virus strains E. coli DH5α cells Thermo Fisher Scientific Cat# 18265017 Chemicals, peptides, and recombinant proteins Penicillin/Streptomycin Thermo Fisher Scientific Cat# 15070063 Fetal bovine serum Sigma-Aldrich Cat# F0193 DMEM Metacell Cat# C1010 RPMI1640 Metacell Cat# C1120 0.25% Trypsin-EDTA solution Metacell Cat# C1201 Liposomal Transfection Reagent Yeasen Cat# 40802ES03 Polybrene Beyotime Cat# C0351 Puromycin dihydrochloride Beyotime Cat# ST551 Blasticidin S HCl Beyotime Cat# ST018 DAPI dihydrochloride MedChemExpress Cat# HY-D0814 Critical commercial assays Seamless Cloning Kit Beyotime Cat# D7010 MolPure Gel Extraction Kit Yeasen Cat# 19101ES50 Hieff Canace High-Fidelity DNA Polymerase Yeasen Cat# 10135ES60 MolPure Endo-free Plasmid Mini Kit Yeasen Cat# 19021ES50 23 SuperTaq PCR StarMix (dye) GenStar Cat# A002-10 Experimental models: Cell lines HEK293T ATCC Cat# CRL-3216 NCI-H1299 ATCC Cat# CRL-5803 Oligonucleotides Seamless Cloning TFEB forward primer: 5′ TCCATAGAAGCCACCATGGCGTCACGCATAGGG 3′ This paper N/A Seamless Cloning TFEB reverse primer: 5′ ATCGAATTCTCTAGACTTGTCGTCATCGTCTTTG 3′ This Transduction:Article Title: Protocol for monitoring the stability of transcription factor EB using global protein stability assay. Article Snippet: Bacterial and virus strains E. coli DH5α cells Thermo Fisher Scientific Cat# 18265017 Chemicals, peptides, and recombinant proteins Penicillin/Streptomycin Thermo Fisher Scientific Cat# 15070063 Fetal bovine serum Sigma-Aldrich Cat# F0193 DMEM Metacell Cat# C1010 RPMI1640 Metacell Cat# C1120 0.25% Trypsin-EDTA solution Metacell Cat# C1201 Liposomal Transfection Reagent Yeasen Cat# 40802ES03 Polybrene Beyotime Cat# C0351 Puromycin dihydrochloride Beyotime Cat# ST551 Blasticidin S HCl Beyotime Cat# ST018 DAPI dihydrochloride MedChemExpress Cat# HY-D0814 Critical commercial assays Seamless Cloning Kit Beyotime Cat# D7010 MolPure Gel Extraction Kit Yeasen Cat# 19101ES50 Hieff Canace High-Fidelity DNA Polymerase Yeasen Cat# 10135ES60 MolPure Endo-free Plasmid Mini Kit Yeasen Cat# 19021ES50 23 SuperTaq PCR StarMix (dye) GenStar Cat# A002-10 Experimental models: Cell lines HEK293T ATCC Cat# CRL-3216 NCI-H1299 ATCC Cat# CRL-5803 Oligonucleotides Seamless Cloning TFEB forward primer: 5′ TCCATAGAAGCCACCATGGCGTCACGCATAGGG 3′ This paper N/A Seamless Cloning TFEB reverse primer: 5′ ATCGAATTCTCTAGACTTGTCGTCATCGTCTTTG 3′ This |